Spot-Tag

Description

The Spot-Tag® (sequence PDRVRAVSHWSS) is used in multiple capture and detection applications. Application optimized reagents are applied, which are based on Spot Nanobodies.

An overview and introduction of the Spot capture and detection tag can be found here.

Specificity
Spot-Tag is a short peptide tag (PDRVRAVSHWSS) and can be bound by Spot VHH, Spot-Label, Spot-Cap, and Spot-Trap.

Applications

Cloning
For ease of cloning, we offer a range of Spot vectors:
Spot-Tag Vectors for cloning
Spot-Tag Vectors - positive control

For additional cloning strategies see below suggestions for codon-optimized sequences and linkers:

Amino acid sequence Spot-Tag
PDRVRAVSHWSS

Position Spot-Tag
N-terminus and C-terminus

Codon optimized sequences for Spot-Tag
E. coli
CCGGATCGCGTGCGCGCAGTCTCTCACTGGAGCAGC

D. melanogaster
CCCGATCGCGTGCGTGCCGTGAGCCACTGGAGCTCG

S. cerevisiae
CCAGATAGAGTTAGAGCTGTTTCTCATTGGTCTTCT

Human cell line
CCAGACCGCGTGCGCGCCGTGAGCCATTGGAGCAGC

A. thaliana
CCTGATAGAGTTAGAGCTGTTTCTCATTGGTCTTCT

Linker (optional)
We recommend a short Gly-Ser linker if there are adjacent acidic amino acids (Glu/Asp):
E. coli  GGTTCT
S. cerevisiae   GGTTCT
Human cell line   GGCAGC

 

Spot Vectors - positive controls

x
Code Description Size Price Qty
Code ev-31 Description pSpot-Tag-Actin vector (plasmid) for expression of Spot-Tag β-actin fusion protein in mammalian cells - positive control Size 10 µg Price $ 65
Qty +
Code ev-32 Description pSpot2_GFP-Spot-Tag vector (plasmid) for expression of GFP-Spot-Tag fusion protein in E. coli - positive control Size 10 µg Price $ 65
Qty +
Code ev-33 Description pSpot8_GFP-Spot-Tag vector (plasmid) for expression of GFP-Spot-Tag fusion protein in S. cerevisiae - positive control Size 10 µg Price $ 65
Qty +

Spot Vectors for cloning

x
Code Description Size Price Qty
Code ev-1 Description pSpot1 vector, E. coli, Spot-tag N-term., Kan., high expression Size 1.25 µg Price $ 65
Qty +
Code ev-2 Description pSpot2 vector, E. coli, Spot-tag C-term., Kan., high expression Size 1.25 µg Price $ 65
Qty +
Code ev-3 Description pSpot3 vector, E. coli, Spot-tag C-term., Amp., low expression Size 1.25 µg Price $ 65
Qty +
Code ev-4 Description pSpot4 vector, E. coli, Spot-tag N-term., Amp., low expression Size 1.25 µg Price $ 65
Qty +
Code ev-5 Description pSpot5 vector, S. cerevisiae, Spot-tag N-term., Leu, CEN, low expression Size 1.25 µg Price $ 65
Qty +
Code ev-6 Description pSpot6 vector, S. cerevisiae, Spot-tag C-term., Leu, CEN, low expression Size 1.25 µg Price $ 65
Qty +
Code ev-7 Description pSpot7 vector, S. cerevisiae, Spot-tag N-term., Leu, 2µ, high expression Size 1.25 µg Price $ 65
Qty +
Code ev-8 Description pSpot8 vector, S. cerevisiae, Spot-tag C-term., Leu, 2µ, high expression Size 1.25 µg Price $ 65
Qty +

Spot Capture and Detection System

ChromoTek’s Spot-Tag® is the first peptide tag, which is bound by a Nanobody, and which is universal applicable in protein capture and detection applications. The Spot-Tag is an inert 12 amino acid peptide-tag (PDRVRAVSHWSS), which is specifically bound by the highly stable and robust anti-Spot-Nanobody.

PRODUCTS

Download Whitepaper
Order Free Test-Sample
Email newsletter

Only for research applications, not for diagnostic or therapeutic use!