Spot-Tag
Description
The Spot-Tag® for various capture and detection applications. Every Spot tool is specifically designed and optimized for a different application.
Specificity
Spot-Tag is a short peptide tag (PDRVRAVSHWSS) and can be bound by Spot VHH, Spot-Label, Spot-Cap, and Spot-Trap.
Applications
- Immunoprecipitation (IP) / Co-IP -> Spot-Trap
- Mass spectrometry (MS) -> Spot-Trap and iST Spot-Trap Kit
- Protein purification -> Spot-Cap
- Immunofluorescence -> Spot-Label
- Western Blotting -> Spot-Label and Spot VHH
Cloning
For ease of cloning, we offer a range of Spot vectors:
Spot-Tag Vectors for cloning
Spot-Tag Vectors - control
If you wish to insert the Spot-Tag into your own vector, you will find some suggestions for codon-optimized sequences and linkers below.
You can find more details about Spot here.
Spot Vectors - positive controls
| Code | Description | Size | Price | Qty |
|---|---|---|---|---|
| Code ev-31 | Description pSpot-Tag-Actin vector (plasmid) for expression of Spot-Tag β-actin fusion protein in mammalian cells - positive control | Size 10 µg | Price $ 65 | |
| Code ev-32 | Description pSpot2_GFP-Spot-Tag vector (plasmid) for expression of GFP-Spot-Tag fusion protein in E. coli - positive control | Size 10 µg | Price $ 65 | |
| Code ev-33 | Description pSpot8_GFP-Spot-Tag vector (plasmid) for expression of GFP-Spot-Tag fusion protein in S. cerevisiae - positive control | Size 10 µg | Price $ 65 |
Spot Vectors for cloning
| Code | Description | Size | Price | Qty |
|---|---|---|---|---|
| Code ev-1 | Description pSpot1 vector, E. coli, Spot-tag N-term., Kan., high expression | Size 1.25 µg | Price $ 65 | |
| Code ev-2 | Description pSpot2 vector, E. coli, Spot-tag C-term., Kan., high expression | Size 1.25 µg | Price $ 65 | |
| Code ev-3 | Description pSpot3 vector, E. coli, Spot-tag C-term., Amp., low expression | Size 1.25 µg | Price $ 65 | |
| Code ev-4 | Description pSpot4 vector, E. coli, Spot-tag N-term., Amp., low expression | Size 1.25 µg | Price $ 65 | |
| Code ev-5 | Description pSpot5 vector, S. cerevisiae, Spot-tag N-term., Leu, CEN, low expression | Size 1.25 µg | Price $ 65 | |
| Code ev-6 | Description pSpot6 vector, S. cerevisiae, Spot-tag C-term., Leu, CEN, low expression | Size 1.25 µg | Price $ 65 | |
| Code ev-7 | Description pSpot7 vector, S. cerevisiae, Spot-tag N-term., Leu, 2µ, high expression | Size 1.25 µg | Price $ 65 | |
| Code ev-8 | Description pSpot8 vector, S. cerevisiae, Spot-tag C-term., Leu, 2µ, high expression | Size 1.25 µg | Price $ 65 |
Spot Capture and Detection System
ChromoTek’s Spot-Tag® is the first peptide tag, which is bound by a Nanobody, and which is universal applicable in protein capture and detection applications. The Spot-Tag is an inert 12 amino acid peptide-tag (PDRVRAVSHWSS), which is specifically bound by the highly stable and robust anti-Spot-Nanobody.
PRODUCTSAmino acid sequence Spot-Tag
PDRVRAVSHWSS
Position Spot-Tag
N-terminus and C-terminus
Codon optimized sequences for Spot-Tag
E. coli
CCGGATCGCGTGCGCGCAGTCTCTCACTGGAGCAGC
D. melanogaster
CCCGATCGCGTGCGTGCCGTGAGCCACTGGAGCTCG
S. cerevisiae
CCAGATAGAGTTAGAGCTGTTTCTCATTGGTCTTCT
Human cell line
CCAGACCGCGTGCGCGCCGTGAGCCATTGGAGCAGC
A. thaliana
CCTGATAGAGTTAGAGCTGTTTCTCATTGGTCTTCT
Linker (optional)
We recommend a short Gly-Ser linker if there are adjacent acidic amino acids (Glu/Asp):
E. coli GGTTCT
S. cerevisiae GGTTCT
Human cell line GGCAGC
Only for research applications, not for diagnostic or therapeutic use!