Spot-Tag
Description
The Spot-Tag® (sequence PDRVRAVSHWSS) is used in multiple capture and detection applications. Application optimized reagents are applied, which are based on Spot Nanobodies.
An overview and introduction of the Spot capture and detection tag can be found here.
Specificity
Spot-Tag is a short peptide tag (PDRVRAVSHWSS) and can be bound by Spot VHH, Spot-Label, Spot-Cap, and Spot-Trap.
Applications
- Immunoprecipitation (IP) / Co-IP: Spot-Trap
- Co-IP/MS: Spot-Trap and iST Spot-Trap Kit
- Protein purification: Spot-Cap
- Immunofluorescence: Spot-Label
- Western Blotting: Spot-Label and Spot VHH
Cloning
For ease of cloning, we offer a range of Spot vectors:
Spot-Tag Vectors for cloning
Spot-Tag Vectors - positive control
For additional cloning strategies see below suggestions for codon-optimized sequences and linkers:
Amino acid sequence Spot-Tag
PDRVRAVSHWSS
Position Spot-Tag
N-terminus and C-terminus
Codon optimized sequences for Spot-Tag
E. coli
CCGGATCGCGTGCGCGCAGTCTCTCACTGGAGCAGC
D. melanogaster
CCCGATCGCGTGCGTGCCGTGAGCCACTGGAGCTCG
S. cerevisiae
CCAGATAGAGTTAGAGCTGTTTCTCATTGGTCTTCT
Human cell line
CCAGACCGCGTGCGCGCCGTGAGCCATTGGAGCAGC
A. thaliana
CCTGATAGAGTTAGAGCTGTTTCTCATTGGTCTTCT
Linker (optional)
We recommend a short Gly-Ser linker if there are adjacent acidic amino acids (Glu/Asp):
E. coli GGTTCT
S. cerevisiae GGTTCT
Human cell line GGCAGC
Spot Vectors - positive controls
Code | Description | Size | Price | Qty |
---|---|---|---|---|
Code ev-31 | Description pSpot-Tag-Actin vector (plasmid) for expression of Spot-Tag β-actin fusion protein in mammalian cells - positive control | Size 10 µg | Price $ 65 | |
Code ev-32 | Description pSpot2_GFP-Spot-Tag vector (plasmid) for expression of GFP-Spot-Tag fusion protein in E. coli - positive control | Size 10 µg | Price $ 65 | |
Code ev-33 | Description pSpot8_GFP-Spot-Tag vector (plasmid) for expression of GFP-Spot-Tag fusion protein in S. cerevisiae - positive control | Size 10 µg | Price $ 65 |
Spot Vectors for cloning
Code | Description | Size | Price | Qty |
---|---|---|---|---|
Code ev-1 | Description pSpot1 vector, E. coli, Spot-tag N-term., Kan., high expression | Size 1.25 µg | Price $ 65 | |
Code ev-2 | Description pSpot2 vector, E. coli, Spot-tag C-term., Kan., high expression | Size 1.25 µg | Price $ 65 | |
Code ev-3 | Description pSpot3 vector, E. coli, Spot-tag C-term., Amp., low expression | Size 1.25 µg | Price $ 65 | |
Code ev-4 | Description pSpot4 vector, E. coli, Spot-tag N-term., Amp., low expression | Size 1.25 µg | Price $ 65 | |
Code ev-5 | Description pSpot5 vector, S. cerevisiae, Spot-tag N-term., Leu, CEN, low expression | Size 1.25 µg | Price $ 65 | |
Code ev-6 | Description pSpot6 vector, S. cerevisiae, Spot-tag C-term., Leu, CEN, low expression | Size 1.25 µg | Price $ 65 | |
Code ev-7 | Description pSpot7 vector, S. cerevisiae, Spot-tag N-term., Leu, 2µ, high expression | Size 1.25 µg | Price $ 65 | |
Code ev-8 | Description pSpot8 vector, S. cerevisiae, Spot-tag C-term., Leu, 2µ, high expression | Size 1.25 µg | Price $ 65 |
Spot Capture and Detection System
ChromoTek’s Spot-Tag® is the first peptide tag, which is bound by a Nanobody, and which is universal applicable in protein capture and detection applications. The Spot-Tag is an inert 12 amino acid peptide-tag (PDRVRAVSHWSS), which is specifically bound by the highly stable and robust anti-Spot-Nanobody.
PRODUCTSOnly for research applications, not for diagnostic or therapeutic use!