Spot-Tag

Description
The Spot-Tag® for various capture and detection applications. Every Spot tool is specifically designed and optimized for a different application.

Specificity
Spot-Tag is a short peptide tag (PDRVRAVSHWSS) and can be bound by Spot VHH, Spot-Label, Spot-Cap, and Spot-Trap.

Applications

For detailed decision guidance between Spot-Trap and Spot-Cap, click here.

Cloning
For ease of cloning, we offer a range of Spot vectors:
Spot-Tag Vectors for cloning
Spot-Tag Vectors - control

If you wish to insert the Spot-Tag into your own vector, you will find some suggestions for codon-optimized sequences and linkers below.

You can find more details about Spot here

Spot Vectors - positive controls

x
Code Description Size Price Qty
Code ev-31 Description pSpot-Tag-Actin vector (plasmid) for expression of Spot-Tag β-actin fusion protein in mammalian cells - positive control Size 10 µg Price $ 65
Qty +
Code ev-32 Description pSpot2_GFP-Spot-Tag vector (plasmid) for expression of GFP-Spot-Tag fusion protein in E. coli - positive control Size 10 µg Price $ 65
Qty +
Code ev-33 Description pSpot8_GFP-Spot-Tag vector (plasmid) for expression of GFP-Spot-Tag fusion protein in S. cerevisiae - positive control Size 10 µg Price $ 65
Qty +

Spot Vectors for cloning

x
Code Description Size Price Qty
Code ev-1 Description pSpot1 vector, E. coli, Spot-tag N-term., Kan., high expression Size 1.25 µg Price $ 65
Qty +
Code ev-2 Description pSpot2 vector, E. coli, Spot-tag C-term., Kan., high expression Size 1.25 µg Price $ 65
Qty +
Code ev-3 Description pSpot3 vector, E. coli, Spot-tag C-term., Amp., low expression Size 1.25 µg Price $ 65
Qty +
Code ev-4 Description pSpot4 vector, E. coli, Spot-tag N-term., Amp., low expression Size 1.25 µg Price $ 65
Qty +
Code ev-5 Description pSpot5 vector, S. cerevisiae, Spot-tag N-term., Leu, CEN, low expression Size 1.25 µg Price $ 65
Qty +
Code ev-6 Description pSpot6 vector, S. cerevisiae, Spot-tag C-term., Leu, CEN, low expression Size 1.25 µg Price $ 65
Qty +
Code ev-7 Description pSpot7 vector, S. cerevisiae, Spot-tag N-term., Leu, 2µ, high expression Size 1.25 µg Price $ 65
Qty +
Code ev-8 Description pSpot8 vector, S. cerevisiae, Spot-tag C-term., Leu, 2µ, high expression Size 1.25 µg Price $ 65
Qty +

Spot Capture and Detection System

ChromoTek’s Spot-Tag® is the first peptide tag, which is bound by a Nanobody, and which is universal applicable in protein capture and detection applications. The Spot-Tag is an inert 12 amino acid peptide-tag (PDRVRAVSHWSS), which is specifically bound by the highly stable and robust anti-Spot-Nanobody.

PRODUCTS

Amino acid sequence Spot-Tag
PDRVRAVSHWSS

Position Spot-Tag
N-terminus and C-terminus

Codon optimized sequences for Spot-Tag
E. coli
CCGGATCGCGTGCGCGCAGTCTCTCACTGGAGCAGC

D. melanogaster
CCCGATCGCGTGCGTGCCGTGAGCCACTGGAGCTCG

S. cerevisiae
CCAGATAGAGTTAGAGCTGTTTCTCATTGGTCTTCT

Human cell line
CCAGACCGCGTGCGCGCCGTGAGCCATTGGAGCAGC

A. thaliana
CCTGATAGAGTTAGAGCTGTTTCTCATTGGTCTTCT

Linker (optional)
We recommend a short Gly-Ser linker if there are adjacent acidic amino acids (Glu/Asp):
E. coli  GGTTCT
S. cerevisiae   GGTTCT
Human cell line   GGCAGC

Download Whitepaper
Order Free Test-Sample
Email newsletter

Only for research applications, not for diagnostic or therapeutic use!